Source: https://guthlabs.ai/docs/instruments/primer-melting-temperature-tm-calculator/implementation/

instrument implementation / implementation-contract

# Primer Melting Temperature (Tm) Calculator implementation

A source-bound implementation contract for Primer Melting Temperature (Tm) Calculator; deployment and executable qualification remain separate.

Status: **VERIFIED_CLEAN**Lifecycle: **implementation-contract**

## Binding contract

This record describes what an executable surface must bind and validate. It does not claim that a public calculator, package, or production route is deployed.

**Record owner**: Guth Instruments

**Lifecycle**: verified-clean

**Evidence ID**: t7-005

**Effect**: Computation or source lookup only

## Input and validation requirements

The specification permits hazardous ambiguity: an empty sequence can produce a misleading raw Wallace value of 0 °C while GC% is undefined, and the nearest-neighbor branch cannot produce a numeric result without the required parameter table and explicit method, unit, and convention validation.

## Required corrections

No binding erratum is attached to this unique-name record. Implementers must still preserve the declared units, domain, and failure behavior.

## Inspectable interface fixture

The sample below is evidence for interface and validation tests, not a production implementation.

````
{
  "inputs": {
    "sequence": "ATGCGTACGATCGATCGTAC",
    "method": "Wallace rule"
  },
  "expected_outputs": {
    "Tm_C": 60,
    "GC_percent": 50
  },
  "reference_data": {
    "wallace_GC_coefficient_C_per_base": 4,
    "wallace_AT_coefficient_C_per_base": 2,
    "source_convention": "widely tabulated standard Wallace-rule values"
  },
  "working": "Length = 20. Count G+C = 10 and A+T = 10. Tm = 4*10 + 2*10 = 40 + 20 = 60 deg C. GC% = 100*(10/20) = 50%."
}
````

## Other records

[01**Overview**](<https://guthlabs.ai/docs/instruments/primer-melting-temperature-tm-calculator/>)[02**Mechanism**](<https://guthlabs.ai/docs/instruments/primer-melting-temperature-tm-calculator/mechanism/>)[04**Qualification**](<https://guthlabs.ai/docs/instruments/primer-melting-temperature-tm-calculator/qualification/>)

## Sources and evidence

These pointers bind the page to evidence. They do not grant authority or collapse verification into deployment.

- `VERIFIED_LEDGER.json`

- `evidence-tranche7/tranche7-results.json`