Primer Melting Temperature (Tm) Calculator

Inspectable records

Ledger state

The current ledger marks this instrument verified clean within the source-bound verification corpus.

Area

Biology, Medicine & Pharmacology (educational estimates only — every panel labeled not-medical-advice)

Tranche

tranche-7

Evidence ID

t7-005

Ledger rows

1

No ledger note is attached.

Review findings

The verdict is NEEDS_REVIEW because two alternative algorithms are named but the nearest-neighbor implementation is not fully defined. Vectors 1-3 exercise exact standard Wallace-rule coefficient entries, including zero-GC and high-GC boundary behavior. The nearest-neighbor vector uses the stated SantaLucia 1998 convention and explicitly supplies every table value needed for reproduction.

Formula and scope findings

• The Wallace rule Tm=4(G+C)+2(A+T) is a standard rough estimate for short, relatively simple oligonucleotides, but its applicability limits should be stated explicitly; it is not generally reliable for long primers, unusual salt conditions, mismatches, secondary structure, or modified bases.
• The salt-adjusted nearest-neighbor method is underspecified: it must define the exact SantaLucia 1998 parameter convention, salt model, oligo concentration convention, self-complementarity treatment, terminal AT corrections, initiation terms, and whether divalent ions are supported.
• The nearest-neighbor formula must specify whether concentration is total strand concentration and whether the non-self-complementary correction ln(Ct/4) or a self-complementary correction is used.
• GC% is not mathematically defined in the specification; the usual definition is 100*(G+C)/sequence length, with ambiguity for empty or ambiguous-base sequences.
• The specification calls the instrument a lookup-table engine but does not state how missing or ambiguous nucleotide symbols are handled.

Unit assumptions

• Sequence contains only uppercase or case-normalized A, C, G, and T bases; ambiguous symbols, gaps, and modified bases are rejected unless separately modeled.
• Wallace-rule coefficients are 4 degrees C per G/C base and 2 degrees C per A/T base; the result is in degrees C.
• GC% is reported as a percentage, not a fraction.
• For the nearest-neighbor vector, SantaLucia-style enthalpies are in kcal/mol, entropies are in cal/(mol*K), R=1.9872 cal/(mol*K), oligo concentration is total strand concentration in mol/L, and monovalent sodium concentration is in mol/L.
• The nearest-neighbor salt correction used here is +16.6*log10([Na+]) degrees C, with [Na+] in mol/L; this is a monovalent-salt approximation and does not independently model Mg2+ or dNTP binding.
• The nearest-neighbor example assumes a non-self-complementary duplex and uses Tm(K)=1000*DeltaH/(DeltaS+R*ln(Ct/4)), followed by conversion to degrees C and the sodium correction.

Boundary hardening

BREAK_CLAIMED · SELF_FLAGGED

The specification permits hazardous ambiguity: an empty sequence can produce a misleading raw Wallace value of 0 °C while GC% is undefined, and the nearest-neighbor branch cannot produce a numeric result without the required parameter table and explicit method, unit, and convention validation.

Errata and corrections

No applied erratum is attached to this unique-name record.

Inspectable example

4 review vectors are recorded. One source-bound sample is shown below.

{
  "inputs": {
    "sequence": "ATGCGTACGATCGATCGTAC",
    "method": "Wallace rule"
  },
  "expected_outputs": {
    "Tm_C": 60,
    "GC_percent": 50
  },
  "reference_data": {
    "wallace_GC_coefficient_C_per_base": 4,
    "wallace_AT_coefficient_C_per_base": 2,
    "source_convention": "widely tabulated standard Wallace-rule values"
  },
  "working": "Length = 20. Count G+C = 10 and A+T = 10. Tm = 4*10 + 2*10 = 40 + 20 = 60 deg C. GC% = 100*(10/20) = 50%."
}

Related workflows

No source-defined multi-instrument workflow membership is recorded.

Sources and evidence

These pointers bind the page to evidence. They do not grant authority or collapse verification into deployment.

• VERIFIED_LEDGER.json · VERIFIED_CLEAN
• evidence-tranche7/tranche7-results.json
• BOUNDARY_HAZARD_CATALOG.json