Primer Melting Temperature (Tm) Calculator implementation

Binding contract

This record describes what an executable surface must bind and validate. It does not claim that a public calculator, package, or production route is deployed.

Record owner

Guth Instruments

Lifecycle

verified-clean

Evidence ID

t7-005

Effect

Computation or source lookup only

Input and validation requirements

The specification permits hazardous ambiguity: an empty sequence can produce a misleading raw Wallace value of 0 °C while GC% is undefined, and the nearest-neighbor branch cannot produce a numeric result without the required parameter table and explicit method, unit, and convention validation.

Required corrections

No binding erratum is attached to this unique-name record. Implementers must still preserve the declared units, domain, and failure behavior.

Inspectable interface fixture

The sample below is evidence for interface and validation tests, not a production implementation.

{
  "inputs": {
    "sequence": "ATGCGTACGATCGATCGTAC",
    "method": "Wallace rule"
  },
  "expected_outputs": {
    "Tm_C": 60,
    "GC_percent": 50
  },
  "reference_data": {
    "wallace_GC_coefficient_C_per_base": 4,
    "wallace_AT_coefficient_C_per_base": 2,
    "source_convention": "widely tabulated standard Wallace-rule values"
  },
  "working": "Length = 20. Count G+C = 10 and A+T = 10. Tm = 4*10 + 2*10 = 40 + 20 = 60 deg C. GC% = 100*(10/20) = 50%."
}

Other records

Sources and evidence

These pointers bind the page to evidence. They do not grant authority or collapse verification into deployment.

• VERIFIED_LEDGER.json
• evidence-tranche7/tranche7-results.json